diphytanoyl sn glycero 3 phosphocholine dphpc avanti polar lipids 850356c 4 (Croda International Plc)

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Croda International Plc diphytanoyl sn glycero 3 phosphocholine dphpc avanti polar lipids 850356c 4
Diphytanoyl Sn Glycero 3 Phosphocholine Dphpc Avanti Polar Lipids 850356c 4, supplied by Croda International Plc, used in various techniques. Bioz Stars score: 97/100, based on 926 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pc+avanti+polar+lipids/4ME+16%3A0+PC/pm41903528-623-167-169
Average 97 stars, based on 926 article reviews

diphytanoyl sn glycero 3 phosphocholine dphpc avanti polar lipids 850356c 4 - by Bioz Stars, 2026-09

97/100 stars

Images

Clinical Proteomics:

Article Title: Metabolite dynamics over the course of anti-tuberculosis treatment in individuals with mild and severe tuberculosis
Article Snippet: .. Plasma samples (0.5 mL) were prepared by adding a 2:1:1 mixture of chloroform (CHCl 3 ), methanol (MeOH), and plasma to a 2 mL final volume, containing 1 nmol of 17:0–20:4 PC (Avanti Polar Lipids) as internal standards for a semi-quantitative analysis. ..

Article Title: Metabolite dynamics over the course of anti-tuberculosis treatment in individuals with mild and severe tuberculosis.
Article Snippet: .. Liquid chromatography and mass spectrometry analysis for lipids Plasma samples (0.5 mL) were prepared by adding a 2:1:1 mixture of chloroform (CHCl 3 ), methanol (MeOH), and plasma to a 2 mL final volume, containing 1 nmol of 17:0–20:4 PC (Avanti Polar Lipids) as internal standards for a semi-quantitative analysis. ..

Liposomes:

Article Title: Systematic Comparison of Commercial Uranyl-Alternative Stains for Negative- and Positive-Staining Transmission Electron Microscopy of Organic Specimens.
Article Snippet: .. Sample Preparation—Phosphatidylcholine (POPC) Liposomes: 16:0- 18:1 PC Avanti Polar lipids were obtained as 25 mg powder from Sigma– Aldrich (850457P Avanti), diluted in 1 mL Ethanol (ACS reagent, Sigma– Aldrich, 02870–2.5L-F), dried again at room temperature by evaporation and resuspended in 600 μL MES (Sigma–Aldrich, M1317) to form liposomes. ..

Article Title: Systematic Comparison of Commercial Uranyl‐Alternative Stains for Negative‐ and Positive‐Staining Transmission Electron Microscopy of Organic Specimens
Article Snippet: .. 16:0‐18:1 PC Avanti Polar lipids were obtained as 25 mg powder from Sigma–Aldrich (850457P Avanti), diluted in 1 mL Ethanol (ACS reagent, Sigma–Aldrich, 02870–2.5L‐F), dried again at room temperature by evaporation and resuspended in 600 μL MES (Sigma–Aldrich, M1317) to form liposomes. ..

Evaporation:

other:

Article Title: Structural insights into pre-pore intermediates of alpha-hemolysin in the lipidic environment
Article Snippet: REAGENT SOURCE IDENTIFIER Bacterial and virus strains Escherichia coli BL21(DE3) Novagen Cat# 69450-3CN Chemicals, peptides, and recombinant proteins Tris Base HiMedia Cat# TC072M Sodium Chloride Qualigens Cat# Q15918 Potassium Chloride Merck Cat# P3911 Potassium di-hydrogen orthophosphate Qualigens Cat# Q19465 Di-sodium hydrogen orthophosphate SD Fine Chemicals Cat# S40158 K05 Luria Broth HiMedia Cat# M575 Isopropyl ß-D-1-thiogalactopyranoside Merck Cat# I6758 Imidazole Sigma Aldrich Cat# 792527-500G 2-Methyl-2,4-pentanediol Sigma Aldrich Cat# 8208190100 L-α-phosphatidylcholine (Egg, Chicken) Avanti Polar Lipids Cat# 840051P-200mg Cholesterol Merck Millipore Cat# C8997-5G Ni-NTA Agarose Qiagen Cat# 30210 Coomassie Brilliant blue R 250 Merck Cat# 1.12553 Precision Plus ProteinTM Dual Color Standards Bio-Rad Cat# #1610374 Amicon Ultra-4 Centrifugal filter unit (10K) Merck Cat# UFC801024 PC Membranes 0.2μm Avanti Polar Lipids Cat# 610006-1EA PC Membranes 1μm Avanti Polar Lipids Cat# 610010-1EA 10mm Filter Supports Avanti Polar Lipids Cat# 610014-1EA Extruder Set with Holder/Heating Block Avanti Polar Lipids Cat# 610000-1EA Syringe (1000 μL) Avanti Polar Lipids Cat# 610017-1EA DSPE-PEG (2000) Biotin Avanti Polar Lipids Cat#880129P-10mg Brain SM Avanti Polar Lipids Cat#860062P-25mg 10:0 PC Avanti Polar Lipids Cat#853025P-25mg 14:0 PC (DMPC) Avanti Polar Lipids Cat#850345C-500mg 16:0 PC (DPPC) Avanti Polar Lipids Cat#850355C-500mg 18:1(Δ9-Cis) PC (DOPC) Avanti Polar Lipids Cat#850375P-1g Rhodamine B Sigma-Aldrich Cat#83689-1G Nile-Red Sigma-Aldrich Cat#72485-100MG 4ME 16:0 NBD PE (NBD-DPhPE) Avanti Polar Lipids Cat#810142C-1mg Streptavidin Egg Liss Rhod PE Avanti Polar Lipids Cat#810146C-5mg Egg PC Avanti Polar Lipids Cat#131601P-5g 12:0 PC Avanti Polar Lipids Cat#850335C-25mg Uranyl Acetate 98%, ACS Reagent Polysciences, Inc Cat# 21447-25 Superdex 200 Increase 10/300 GL Cytiva Cat# GE28-9909-44 EM grid (Carbon film 300 mesh, Copper) Electron Microscopy Sciences Cat# CF300-CU EM grid (Quantifoil R 1.2/1.3 300 Mesh, Copper) Electron Microscopy Sciences Cat# Q3100CR1.3 Quantifoil R 1.2/1.3, UT, 300 Mesh, Copper Electron Microscopy Sciences Cat# Q3100CR1.32nm 4',6-diamidino-2-phenylindole Thermofisher Scientific Cat#D1306 Atto 647N Maleimide Sigma Aldrich Cat#05316 Streptavidin Sisco Research Laboratories Cat#87610

RNA Sequencing:

Article Title: LPLAT11/MBOAT7-driven phosphatidylinositol remodeling ensures radial glial cell integrity in developing neocortex
Article Snippet: .. Cat# I0258 Sevenin-1 Enamine Ltd. Cat# Z1084980652 UNC3230 TargetMol Cat# T23498 17:0-20:4 PI Avanti Polar Lipids Cat# LM1502 17:0-20:4 PI4P Avanti Polar Lipids Cat# LM1901 17:0-20:4 PI(4,5)P2 Avanti Polar Lipids Cat# LM1904 12:0-13:0 PI Avanti Polar Lipids Cat# LM1500 Jo ur al Pr e-p roo f 12:0-13:0 PS Avanti Polar Lipids Cat# LM1300 12:0-13:0 PC Avanti Polar Lipids Cat# LM1000 12:0-13:0 PE Avanti Polar Lipids Cat# LM1100 (Trimethylsilyl)diazomethane Sigma-Aldrich Cat# 362832 Acetic Acid for LC/MS Fujifilm Cat# 018-20061 Critical commercial assays Deposited data Bulk RNA-seq data Gene Expression Omnibus (GEO) database GSE288356 ID: 200288356 LC-MS/MS data Metabolomics workbench ID: ST003747 SFC-MS/MS data Metabolomics workbench ID: ST003748, ST003749 Arachidonic acid incorporation into phosphatidylinositol by LPLAT11/MBOAT7 ensures radial glial cell integrity in developing neocortex BioRχiv https://doi.org/10.11 01/2024.04.30.5880 48 Experimental models: Cell lines Experimental models: Organisms/strains Mouse: C57BL/6N CLEA Japan N/A Mouse: Mboat7 KO This laboratory N/A Mouse: B6.B6CB-Sox1 Riken No. CDB0525K Oligonucleotides Primers to amplify mClover3 for cloning into the pCAGGS vector forward: ATCCACCGGCCGGTCGCCACCATGGTGAGCAAGG GCGAGGA; reverse: CTTCTGCTCCTCGAGCTACTTGTACAGCTCGTCCAT GC Eurofins Genomics N/A Primers to amplify E-cadherin for cloning into the pCAGGS vector forward: CCGGGTACCGAATTCGCCACCATGGGAGCCCGGTG CCGCAG reverse: CTTCTGCTCCTCGAGCTAGTCGTCCTCACCACCGCC GTAC Eurofins Genomics N/A Recombinant DNA Software and algorithms Prism (version 8) GraphPad Software https://www.graphpa d.com Fiji/ImageJ Fiji/ImageJ https://imagej.net/sof tware/fiji/ Analyst○R1.7.2 AB SCIEX https://sciex.jp/produ cts/software/analystsoftware MultiQuant 3.0.3 AB SCIEX https://sciex.jp/produ cts/software/multiqu ant-software Jo urn al Pr e-p roo f Other Confocal laser microscope Leica SP8 Cyostat Leica CM1950 Luminescent image analyzer Cytiva ImageQuant LAS4000 Western blot and chemiluminescence imaging system VILBER Fusion Solo S Nitrogen gas generator SYSTEM INSTRUMENTS Co.,Ltd. .. Model 05BL Sonicator Branson SFX 250 Microinjector Eppendorf Femtojet○R 4i Elecroporator Nepagene NEPA21 Electrodes Nepagene CUY650-P3 Triple quadrupole linear ion trap mass spectrometer AB SCIEX QTRAP4500 Jo urn al Pr e-p roo f

Gene Expression:

Cloning:

Plasmid Preparation:

Recombinant:

Article Title: The solute carrier SPNS2 recruits PI(4,5)P2 to synergistically regulate transport of sphingosine-1-phosphate
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Monoclonal Anti-FLAG M2 antibody Sigma Cat# F3165-.2MG Anti-b-actin antibody Cell Signaling Technology Cat# 3700S Bacterial and virus strains DH10Bac Competent Cells Thermo Fisher Scientific Cat# 10361012 Stellar Competent Cells Takara Cat# 636763 Chemicals, peptides, and recombinant proteins n-Dodecyl-b-D-maltopyranoside (DDM) Anatrace Cat# D310 18:1 PI Avanti Polar Lipids Cat# 850149P-500mg 18:1 PI(4)P Avanti Polar Lipids Cat# 850151P-500mg 18:1 PI(4,5)P2 Avanti Polar Lipids Cat# 850155P-500mg 18:1 PI(3,4,5)P3 Avanti Polar Lipids Cat# 850156P-500mg 16:0-18:1 PA Avanti Polar Lipids Cat# 840857P-500mg 16:0-18:1 PS Avanti Polar Lipids Cat# 840034P-500mg 16:0-18:1 PG Avanti Polar Lipids Cat# 840457P-500mg 16:0-18:1 PE Avanti Polar Lipids Cat# 850757P-500mg 16:0-18:1 PC Avanti Polar Lipids Cat# 850457P-500mg Sphingosine 1-phosphate Sigma Cat# 73914-1MG Deuterium oxide Sigma Cat# 151882-100G Lipofectamine 2000 Thermo Fisher Scientific Cat# 11668019 ISA-2011B MedChemExpress Cat# HY-16937-5mg UNC3230 Cayman Chemical Cat# 16401-5 mg-CAY Critical commercial assays Human S1P ELISA kit MyBioSource Cat# MBS2516132 PI(4,5)P2 ELISA kit Echelon Biosciences Cat# K-4500 Experimental models: Cell lines Human: 293T cells ATCC Cat# CRL-3216 Human: Expi293F cells Thermo Fisher Scientific Cat# A14527 Insect: Sf9 cells Thermo Fisher Scientific Cat# 11496015 Deposited data Raw data This paper https://doi.org/10.17632/vcwttwj4z7.1 Recombinant DNA pcDNA5/TO empty vector Thermo Fisher Scientific Cat# V103320 pHTBV1.1 with C-terminal twin-Strep and 103His tag This paper N/A pHTBV1.1-SPNS2-GFP This paper N/A pHTBV1.1-truncated SPNS2 This paper N/A pcDNA5/TO-SPNS2-FLAG This paper N/A pcDNA5/TO-truncated SPNS2-FLAG This paper N/A pcDNA5/TO-SPNS2(R23-28A)-FLAG This paper N/A pcDNA5/TO-SPNS2(R28A)-FLAG This paper N/A pcDNA5/TO-SPNS2(R43A)-FLAG This paper N/A pcDNA5/TO-SPNS2(R164A)-FLAG This paper N/A pcDNA5/TO-SPNS2(R313A)-FLAG This paper N/A (Continued on next page) Molecular Cell 83, 2739–2752.e1–e5, August 3, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER pcDNA5/TO-SPNS2(K391A)-FLAG This paper N/A pcDNA5/TO-SPNS2(R532A)-FLAG This paper N/A pcDNA5/TO-EGFP-SPNS2 This paper N/A pcDNA5/TO-EGFP-truncated SPNS2 This paper N/A pcDNA5/TO-EGFP-SPNS2(R23-28A) This paper N/A pcDNA5/TO-EGFP-SPNS2(R28A) This paper N/A pcDNA5/TO-EGFP-SPNS2(R43A) This paper N/A pcDNA5/TO-EGFP-SPNS2(R164A) This paper N/A pcDNA5/TO-EGFP-SPNS2(R313A) This paper N/A pcDNA5/TO-EGFP-SPNS2(K391A) This paper N/A pcDNA5/TO-EGFP-SPNS2(R532A) This paper N/A Software and algorithms GraphPad Prism 9 GraphPad https://www.graphpad.com/ Volocity 6.3.1 PerkinElmer http://www.cellularimaging.com Xcalibur 4.4 Thermo Fisher Scientific https://thermo.flexnetoperations.com/ Proteome Discoverer 2.5 Thermo Fisher Scientific https://thermo.flexnetoperations.com/ Lipid Search 4.2 Thermo Fisher Scientific https://thermo.flexnetoperations.com/ MassLynx V4.1 Waters N/A ProteinLynx Global Server 2.5.1 Waters N/A DynamX 3.0 Waters N/A Other Superdex 200 Increase 10/300 GL column GE Healthcare Cat# 28-9909-44 Acclaim PepMap 100, C18, 75 mm3 15 cm Thermo Fisher Scientific Cat# 164568 Enzymate BEH Pepsin Column 2.1 3 30 mm Waters Cat# 186007233 ACQUITY UPLC BEH C18 1.7 mm 1.0x100 mm Waters Cat# 186002346 ll OPEN ACCESS Article

Review

diphytanoyl sn glycero 3 phosphocholine dphpc avanti polar lipids 850356c 4 (Croda International Plc)

Structured Review

Images

Related Articles

Clinical Proteomics:

Liposomes:

Evaporation:

other:

RNA Sequencing:

Gene Expression:

Cloning:

Plasmid Preparation:

Recombinant:

Software:

Microscopy:

Western Blot:

Imaging:

Virus:

Enzyme-linked Immunosorbent Assay:

Liquid Chromatography:

Mass Spectrometry:

Similar Products

Image Search Results